quinta-feira, 17 de dezembro de 2015

Prova final de BiolMol

Será às 12:00 da segunda feira dia 21 de dezembro,em sala a determinar.

Gabarito da Segunda avaliação de IBCM, aplicada em 14 de dezembro de 2015

Cada questão vale 1/2 ponto.

1.        Que tipo de indução está representada na figura a lado?

a)        Interna
b)       Endógena
c)        Autócrina
d)       Recorrente
e)       Autolimitante

2.        Considere a seguinte frase: ““Degradação do fosfatidilinositol-4,5-bifosfato (PIP2), fosfolipídio de membrana, que gera o trifosfato de inositol (IP3) e o diacilglicerol (DAG)”. Que tipo de sinal está sendo mencionado?
a)        Sinal duplo
b)       Sinal endócrino
c)        Mensageiro citoplasmático
d)       Sinal subpelicular (de membrana)
e)       Segundo mensageiro

3.        Uma proteína sintetizada pelo ribossomo aderido ao retículo endoplasmático pode ter como destino final:
a)        O exterior da célula ou a membrana plasmática
b)       A membrana plasmática, as cisternas do Golgi ou as mitocôndrias
c)        As cisternas do Golgi, os peroxissomos ou o núcleo
d)       O exterior da célula ou qualquer organela
e)       O próprio retículo, pois ela fica ancorada em sua membrana

4.        As vesículas que trafegam entre os componentes do sistema de endomembranas são cobertas por proteínas estruturais que lhes dão resistência. Que proteína recobre as vesículas que trafegam levando moléculas depois de sua glicosilação final?
a)        Cop1
b)       Cop 2
c)        Triskelion e APAF
d)       Vimentina
e)       Clatrina
f)         Cinetcina ou Dinectina

5.        A célula elimina organelas envelhecidas pelo mecanismo de autofagia, que inclui a formação do autofagossomo. Quem fornece a membrana para a formação do autofagossomo e como o seu conteúdo é destruído?
a)        A membrana vem do endossomo e o conteúdo é destruído pelo proteassomo
b)       A membrana vem do retículo endoplasmático liso e o conteúdo é destruído por enzimas líticas
c)        A membrana vem do endossomo e o conteúdo é destruído por enzimas líticas
d)       A membrana vem das cisternas do Golgi e o conteúdo é destruído por enzimas líticas
e)       A membrana vem da fusão de lisossomos e o conteúdo é destruído pelas enzimas do próprio lisossomo.

6.        Os microtúbulos são compostos por polimerização de duas moléculas, processo este regulado por uma terceira. São elas:
a)        Actina, miosina e tropomiosina
b)       Tubulina, plectina e MAP
c)        Tubulina, spectrina e proteína centriolar
d)       Alfa e beta tubulinas e MAP
e)       Actina, miosina e spectrina

7.        Os desmossomos são locais onde as membranas celulares de duas células contíguas são aderidas devido às proteínas denominadas
a)        adesina e plectina
b)       desmoplaquina e caderina
c)        spectrina e gleína
d)       clatrina e desmogleína
e)       actina e integrina

8.        Cinesina e cinectina são proteínas necessárias para
a)        A translocação de proteínas através da membrana plasmática
b)       O deslocamento de vesículas no interior da célula
c)        O transporte de macromoléculas para organelas
d)       O transporte de macromoléculas para o núcleo
e)       A formação de vesículas no R.E. e no Golgi

9.        Observe como os monômeros se agrupam e responda: a figura a seguir representa
a)        A formação de um filamento de actina
b)       A formação de um microtúbulo mitótico
c)        A formação de um microtúbulo citoplasmático
d)       A formação de um filamento intermediário
e)       A formação de colágeno


10.     Que molécula abaixo não aparece como sinalizadora no processo de comunicação intercelular?
a)        Proteína
b)       Esteroide
c)        Ácido nucleico
d)       Peptídeo
e)       Óxido nítrico

11.     Um hormônio é um sinalizador que se distribui por todo o corpo. Porque só algumas células respondem a determinado hormônio, e não todas as células do corpo?
a)        Porque o hormônio não alcança todas as células
b)       Porque o hormônio é seletivamente degradado em certos órgãos
c)        Porque o hormônio é seletivamente degradado em certos tecidos
d)       Porque apenas as células endócrinas respondem a hormônios
e)       Porque apenas as células que têm o receptor específico respondem ao hormônio

12.     Os receptores na membrana plasmática são sempre:
a)        Glicoproteínas
b)       Lipoproteínas
c)        Ancorados por fosfatidilinositol
d)       Proteínas integrais de membrana
e)       Riboproteínas

13.     Quando um ligante ativa um receptor com atividade enzimática, o que ocorre nas  moléculas?
a)        Uma ligação covalente
b)       A proteólise da extremidade carboxiterminal do receptor
c)        A proteólise da extremidade aminoterminal do receptor
d)       A mudança de conformação do ligante e do receptor
e)       O transporte do ligante para o citoplasma e sua digestão enzimática

14.     Examine a figura abaixo e escolha o item que esclarece porque o receptor intracelular não atua sem o sinal.
a)        O sinal (indutor) transporta o receptor pelo poro nuclear
b)       O sinal é o cofator enzimático indispensável à atividade de regulação gênica
c)        O sinal é o catalizador da atividade enzimática indispensável à atividade de regulação gênica
d)       O sinal é também reconhecido por um receptor na carioteca
e)       O sinal muda a conformação do receptor e permite sua passagem pela carioteca


15.     O que ocorre quando um receptor que é um canal iônico é ligado pelo sinal?
a)        O canal pode se abrir ou fechar
b)       O canal fica bloqueado
c)        O receptor tem sua atividade enzimática ativada
d)       O receptor interioriza o sinal
e)       O receptor se oligomeriza

16.     Que características fisico-químicas deve ter um segundo mensageiro?
a)        Ser uma molécula pequena ou mesmo um íon
b)       Não ter carga
c)        Ser resistente à proteólise
d)       Ter atividade enzimática
e)       Não ter atividade enzimática

17.     Onde ocorre a maior parte da síntese dos fosfolipídeos de membrana da célula?
a)        No citoplasma
b)       Nos peroxissomos
c)        Na mitocôndria
d)       No retículo endoplasmático liso
e)       Nas cisternas do Golgi

18.     Observe a figura abaixo e responda: o que está indicado em A e B?
a)        O tRNA e a chaperona do R.E.
b)       O tRNA e o ligante do receptor no R.E.
c)        O peptídeo sinal e a peptidase sinal
d)       O mRNA e a chaperona do R.E.
e)       A proteína nascente e o ligante dela no R.E.



19.     Ainda com base na mesma figura, o que representa a estrutura em azul indicada pela letra C?
a)        Uma chaperona
b)       O mRNA translocado para o R.E.
c)        O mRNA que dará origem a uma proteína de exportação
d)       Uma proteína a ser secretada
e)       Uma proteína de membrana

20.     Que processo está representado na figura abaixo?
a)        Pinocitose específica, recarga de fosfolipídeos de membrana e formação do lisossomo
b)       Fagocitose específica, recarga de fosfolipídeos de membrana e formação do endossomo primário
c)        Pinocitose inespecífica, recirculação de receptor de membrana e formação do lisossomo
d)       Endocitose inespecífica, recarga de membrana e fusão de enzimas hidrolíticas no lisossomo
e)       Fagocitose inespecífica, recarga de fosfolipídeos de membrana e formação do lisossomo











sábado, 12 de dezembro de 2015

Complexo SNARE e a fusão das vesículas de acetilcolin

Há um artigo com boas imagens sobre o complexo SNARE aqui:

Uma das imagens é essa:


Cuja legenda segue:

The model of the stimulatory SNARE zippering by Syt1 and Ca21. In this model, syntaxin-1A (red) and SNAP-25 (green) pre-assemble int0 the binary t-SNARE complex at plasma membrane, while VAMP2 (blue) and Syt1 (pink) are anchored on the vesicle membrane. In the stage of vesicle docking, Syt1 binding to the binary t-SNARE complex facilitates the synaptic vesicle docking with the plasma membrane53,54. The N-terminus of the binary t-SNARE complex then start zippering with the N-terminus of VAMP2, and form into a partially zipped trans SNARE complex. Upon the rise of the Ca21 level Syt1-Ca21 interacts with the partially zipped complex and facilitates the SNARE zippering at membrane proximal region, which drives the vesicle fusion.

Dica sobre DMD - Distrofia muscular de Duchenne


Que tal explorarem este link?


Da figura que aparece lá (e está abaixo) vocês terão acesso a informações importantes e de alta qualidade. Mas atenção: o link para o artigo completo só abre se vocês estiverem usando a rede wireless da UFCG (ou outra instituição conveniada com a CAPES).


quinta-feira, 26 de novembro de 2015

Instruções para o trabalho de Contração muscular

Caros.

O trabalho sobre Contração Muscular deve ser estruturado da seguinte forma (incluir itens bem identificados):

a) uma primeira parte geral para todos os alunos, revendo como o sinal nervoso chega à extremidade do neurônio, o que acontece aí, como a célula muscular  recebe no novo sinal, como ele é transduzido no seu interior, como chega nos compartimentos de endomembrana que são relevantes para a contração muscular, como as fibras musculares respondem, etc. Todo o enfoque deve ser celular e molecular, com ênfase nos receptores, sinais, moléculas efetoras, etc. Esta primeira parte deve ser um texto corrido, sem divisões, masapoiado com figuras. A parte relativa à estrutura da junção neuro muscular e do músculo deve ser restrita ao que é relevante para a compreensão da contração. Fica didádtico fazer dois itens separados e iniciais para rever estes dois temas.
Sugiro que a primeira parte não tenha mais que 2 páginas, mas se vocês incluirem revisçoes sobre estrutura do músculo e do botão sináptico, vai chegar a 3 páginas facilmente.

Divida seu trabalho em itens. Ele deve ter uma pequena introdução (dois parágrafos ou três, no máximo), onde você vai dizer o que é o trabalho, como ele vai ser desenvolvido e mais alguma informação que queira. Depois deve haver ao menos três itens: estrutura da célula muscular, estrutura da junção neuromuscular e processo de excitação-contração (que é o item mais longo), nesta ordem. A fonte é calibri 10 e o espaçamento simples (espaço 1). Toda figura deve ter a origem e uma legenda (depois da figura) muito boa, muito explicativa. As referências devem ser citadas ao longo do texto, sempre que possível e listadas completas no final


b) uma segunda parte que explicará um tema escolhido por cada um de vocês. Somando com a primeira parte o texto não pode ter mais que cinco páginas, tamanho A4, margens normais, fonte calibri 10. Novamente a ênfase absoluta é nos aspectos moleculares e celulares do tema específico.

c) a bibliografia da primeira e da segunda parte está incluída nas 5 páginas.

d) as figuras, tabelas ou gráficos (e suas legendas) não contam no total de páginas, MAS DEVEM ESTAR INCLUIDAS NO TEXTO, NO L,UGAR ONDE SÃO CITADAS, E NÃO NO FINAL. Por isso o texto final pode ter bem mais que cinco páginas.

e) dE NOVO...não separem as figuras e suas legendas em páginas separadas: o texto final deve parecer um capítulo de livro, não um trabalho a ser submetido a uma revista...

f) a capa não conta nas 5 páginas de texto.


g) não copiem e colem: reinterpretem o que forem lendo, anotem e depois juntem opiniões de várias fontes nas suas próprias frases. Se houver opiniões conflitantes, mostrem isso: valoriza o trabalho.

terça-feira, 26 de maio de 2015

Animações de replicação de DNA


https://www.youtube.com/watch?v=27TxKoFU2Nw – Esta animação mostra as duas DNA polimerases (III ou alfa) trabalhando no mesmo sentido, isto é, entrando na forquilha de replicação, mas esclarece como uma pode ler uma fita molde que está no sentido oposto à que a outra DNA polimerase está lendo. A animação começa com a estrutura do DNA e segue mostrando a replicação da fita descontínua, com a formação dos fragmentos de Okazaki.




o modelo empregado para a maior parte das explicações é o DNA “de perna aberta” e as duas DNA pol III trabalham separadas. Nesta animação a forquilha fica parada sempre no centro da tela e o “fundo” se desloca. Leading strand é a fita contínua e lagging strand a descontínua, em tradução para o português usado em biologia molecular. As figurinhas das proteínas na parte de cima à direita da animação contêm mais informação, basta passar o mouse por cima. É importante explorar bem esta animação: ela é composta de 4 partes, acessíveis no texto em azul claro acima no quadro da animação. No final da animação está o Modelo de trombone, que é o mesmo da animação anterior. Está muito claro como funciona a alça de DNA fita simples necessária para que a DNA pol da fita descontínua leia o DNA molde no sentido 3´-5´.


segunda-feira, 25 de maio de 2015

Dicas para a primeira avaliação de Biologia Molecular e Celular – maio 2015

A seguir vão os links para as postagens ou páginas que tratam do conteúdo desta avaliação. Entretanto, o mais importante é ler os livros!!!

Aliás, o conteúdo da avaliação será:
·         Origem da vida.
·         Estrutura da célula e dos virus: visão geral.
·         Membranas celulares
·         Componentes do citosol.
·         Núcleo, estrutura do DNA e organização dos genes e cromossomos
·         Replicação e transcrição de DNA (sem entrar no mecanismo de splicing)

P     Entretanto, pode haver perguntas sobre introns e exons (organização dos genomas)



Parece pouca coisa, mas não é.

Para a parte de estrutura do DNA e replicação há alguma coisa na nossa página da UFPE:

Os demais assuntos não estão no blog Genmol. Passo a seguir os links para os poucos conteúdos que estão online e que dizem respeito a esta prova:



Há um bom número de perguntas com respostas sobre o assunto da avaliação, fora as várias provas (avaliações) que estão espalhadas no GenMol e no Biolmol (UFPE). As perguntas deste semestre estão linkadas a seguir. Atenção, não há perguntas sobre todo o conteúdo (por exemplo, não há questões sobre os componentes lipídicos das membranas):

·         Perguntas e respostas sobre os seres vivos, estrutura básica

·         Perguntas e respostas sobre os omponentes do citosol

·         Perguntas e respostas de replicação e transcrição




Há também provas e exercícios nos links para estudo garimpados do GenMol (várias provas e exercícios na parte de replicação/transcrição/tradução/código genético/controle da expressão gênica : http://genmol.blogspot.com.br/2014/02/links-para-estudo-garimpados-do-genmol.html. Algumas vezes, entretanto, estas questões estarão acima do nível exigido na disciplina Introdução à Biologia Molecular e Celular.

quinta-feira, 14 de maio de 2015

Perguntas para serem respondidas até segunda - 18 de maio e sexta - 22 de maio de 2015

Assunto: Tradução e código genético. Processamento de proteínas e regulação da tradução

Turma regular: responder as ímpares. Entrega sexta feira, na aula
Turma DP: responder as pares. Entrega segunda feira, na aula

1. O que se entende por tradução em biologia molecular?
2. Os tRNAs trazem os aminoácidos para a cavidade A do ribossomo. Mas que enzima “carrega” os tRNAs com seus aminoácidos? Como a enzima “sabe” que o anticódon do tRNA corresponde ao aminoácido que será ligado na extremidade 3´?
3. O que determina que um tRNA entre na cavidade A? O que determina sua permanência lá?
4. No processo de extensão do polipeptídeo nascente, o que ocorre com a cadeia de aminoácidos ligados ao tRNA na cavidade P quando entra um tRNA na cavidade A?
5. O que determina a ligação da subunidade menor do ribossomo ao mRNA procarioto? Por que este mecanismo permite a produção de várias proteínas a partir de um mRNA policistrônico (ou poligênico)?
6. Como o ribossomo se liga à sequência de Shine-Dalgarno?
7. Como o ribossomo se liga a um mRNA eucarioto?
R: A subunidade menor se liga previamente ao tRNA para metionina, a alguns fatores de
8. O que determina o fim da tradução de um gene no mRNA? O que ocorre com o ribossomow
9. Quando há dois genes transcritos num mesmo mRNA (o caso dos mRNAs poligênicos procariotos), como é possível traduzir o segundo gene uma vez que os ribossomos se desagregam no códon de parada do primeiro gene?
10. Por que se diz que o código genético é degenerado?
11. Por que os aminoácidos mais frequentes têm mais códons?
12: Porque se diz que a transcrição e a tradução estão acopladas nas bactérias? Porque isso não é possível nos eucariotos?
13. Exemplifique a ação de antibióticos que bloqueiam a síntese proteica
14. O que é um polissomo?
15. Há dois mecanismos básicos de inibição da tradução em eucariotos. Nomeie-os.
R.: Ação de proteínas repressoras da tradução e Bloqueio da tradução e/ou destruição do mRNA por microRNAs não codificantes (RNAs de interferência)
16. Como funciona a inibição da tradução que depende da sequência 3´-não traduzida do mensageiro eucarito?
17. Quando uma proteína é sintetizada, muitas vezes é ligada por chaperonas. O que acontece quando esta proteína tem que cruzar a membrana de uma organela?
18. As proteínas podem ser modificadas pela adição de carboidratos. Exemplifique?
19. O que é prenilação?

20 Para que serve uma âncora de fosfatidil-inositol?

quarta-feira, 13 de maio de 2015

Perguntas e respostas de replicação e transcrição

 Referentes às aulas de segunda feira, 11 de maio e quarta feira 13 de maio de 2015.

1. No diagrama de fluxo da informação genética, como proposto por Watson e Crick, a informação é mantida no nível do DNA e é transmitida pelo RNA até a formação da proteína. Assim, só haveria um sentido neste fluxo: do DNA para a proteína. Entretanto, Howard Temin e David Baltimore mostraram independentemente que havia ao menos em alguns casos uma inversão deste fluxo. Qual é ela e em que casos acontece?
 R.: a TRANSCRIÇÃO REVERSA, na qual o RNA é copiado numa fita única de DNA. Os pesquisadores mencionados mostraram que isso ocorre nos retrovírus, mas depois se viu que muitos eucariotos tem uma transcriptase reversa, inclusive os mamíferos.

2. Existe outra forma de conservar a informação genética que não seja a replicação de DNA? Se sim, em que casos isso acontece?
R.: A informação pode ser mantida no nível do RNA. Isso ocorre apenas em alguns vírus, até hoje.

3. A doença da vaca louca é um caso de replicação de proteína? Argumente.
R.: Não é um caso de replicação, como a dos ácidos nucleicos. De fato, um príon mutante (o que dá a doença da vaca louca ou encefalite espongiforme bovina) é capaz de produzir outra molécula idêntica (uma proteína), mas para isso precisa ter um príon normal para poder editar (isto é, mudar os aminoácidos). Então, este é um caso de edição de aminoácidos, algo muito incomum na natureza, mas não exclusivo dos príons. 

4. Porque se diz que as fitas de um DNA são antiparalelas?
R.: Por causa do sentido bioquímico imposto pelas ligações fosfodiéster, gerando uma extremidade 5´ contendo um fosfato, e outra 3´ contendo uma hidroxila, na qual (e somente nela) podem ser adicionados novos nucleotídeos. As duas fitas pareiam entre si em sentidos opostos e daí a denominação - “anti-paralela”.

5. Por que se diz que a replicação do DNA é semi-conservativa? Que experimento provou isso?
R.: Por que uma fita velha (original) fica pareada com uma fita nova. O experimento que provou isso marcava as duas fitas velhas com carbono 14 e depois acompanhava o peso das fitas duplas resultantes, à medida que iam incorporando o isótopo não radioativo (carbono 13).  Este exprimento foi feito por Meselson e Stahl em 1958 (5 anos depois da elucidação da estrutura do DNA por Watson e Crick)

6. O que é a forquilha de replicação?
R.: É o trecho do DNA fita dupla onde se aloja o replicossomo e, portanto, onde a replicação avança para dentro da fita dupla original.

7. Como é possível que duas DNA polimerases trabalhem unidas no replicossomo se as fitas de DNA são anti-paralelas?
R.: De fato as duas DNA polimerases (III ou alfa, dependendo se for um procarioto ou um eucarioto) estão unidas, mas uma delas se liga à fita de DNA molde 3´-5´ e produz uma fita descontinuamente enquanto a outra se liga a uma longa alça formada pelas fita molde 5´-3´ que, por causa desta alça, acaba se encaixando na DNA polimerase no mesmo sentido da outra fita molde. Esta alça implica que a replicação desta segunda fita será descontínua, isto é, tanto será interrompida periodicamente como os fragmentos de DNA fita simples novos não aparecerão imediatamente ligados uns aos outros.

8. O que são fragmentos de Okasaki
R.: São os fragmentos de DNA fita simples recém sintetizados a partir da fita molde que, na forquilha de replicação, aparece no sentido 5´-3´.

9. De que necessitam as DNA polimerases para agir?
R.: a) Um DNA fita simples para ser empregado como molde, b) um pequeno trecho fita dupla neste molde (pode ser DNA-DNA ou DNA-RNA), que vai oferecer a extremidade 3´-OH para a colocação do primeiro novo nucleotídeo, c) precursores de nucleotídeos trifosfatados e d) pH e sais (sobretudo Mg++)

10. Por que a DNA polimerase não consegue replicar a extremidade de uma fita dupla de DNA?
R.: Porque uma das fitas molde (a de sentido 3´-5´) determinará a colocação de um primer de RNA na extremidade da fita, mas ao ser retirado impossibilita o preenchimento do espaço por bases de DNA porque não há outra hidroxila 3´ disponível.

11. Qual a função enzimática de uma telomerase?
R.: A de uma transcriptase reversa. Entretanto, a telomerase só transcreve poucas bases do RNA que faz parte de sua estrutura (nos mamíferos, seis bases).

12. Qual a sequência de bases de um telômero humano? Há diferenças entre ele e os de outros mamíferos?
R.: TTAGGG. A sequência é conservada entre todos os vertebrados! Abaixo uma tabela que mostra alguns dos telômeros em vários grupos de seres vivos. Observe que as bactérias (Monera) não têm telômeros listados: é porque não precisam, uma vez que o DNA fitadupla do genoma (e dos plasmídeos) é circular.

Algumas sequência de nucleotídeos conhecidas para telômeros (Fonte: Wikipédia)
Grupo
Organismo
Repetição telomérica (5'- 3')
TTAGGG
TTAGGG
Micetozoários
TTAGGG
AG(1-8)
Kinetoplastídeos
TTAGGG
Ciliados
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexos
TTAGGG(T/C)
Plantas superiores
TTTAGGG
TTTTAGGG
TTAGG
Nematelmintos
TTAGGC
TTAC(A)(C)G(1-8)
TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
TCTGGGTG
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT


13. Qual a função do tRNA, do mRNA e do rRNA?
R.: A) O tRNA (RNA de transferência ou de RNA transportador) traz o aminoácido ligado a ele para a cavidade A do ribossomo e se liga ao mRNA através de seu anticodon. O tRNA também mantém transientemente a cadeia nascente de aminoácidos na cavidade P e a transfere para outro tRNA entrante na cavidade A no processo de síntese proteica. B) O mRNA transporta a informação genética para a síntese proteica do DNA no núcleo para os ribossomos no citoplasma. C) os rRNA (RNAs ribossomais) vão formar, junto com dezenas de proteínas, as duas subunidades do ribossomo.

14. No processo de transcrição em que sentido é lido o DNA molde e em que sentido é produzido o RNA?
R.: A fita simples do DNA molde é lida no sentido 3´-5´ pela RNA polimerase e o RNA é sintetizado no sentido oposto.

15. Onde começa o processo de transcrição no DNA?
R.: No promotor

16. Onde termina o processo de transcrição do DNA?
R.: No terminador.

17. Quais as características de um promotor bacteriano (de E. coli)?
R.: O promotor tem duas caixas de consenso, compostas por cerca de seis pares de bases, separadas por aproximadamente 20 pares de bases (duas voltas de DNA). A caixa TATA é rica em A e T e está na posição -10 (a base +1 no DNA corresponde à primeira base transcrita em RNA) e a caixa -35 é rica em G e C e está na posição -35. A sequência entre as caixas de consenso pode variar, mas não pode ser encurtada nem aumentada.

18. Quais as características de um terminador bacteriano (de E. coli)?
R.: Duas sequências idênticas, mas invertidas no DNA, seguidas de um poliA na fita “sense”. A consequência deste arranjo de bases é que, no RNA transcrito, forma-se um grampo, seguido de um poliU.

19. O que é o processo de splicing?
R.: A retirada de introns (e algumas vezes de exons entre dois ou mais introns) do transcrito primário de RNA, no processo de maturação do mRNA.

20. Como é possível a partir de um único gene gerar várias proteínas?

R.: A resposta deve incluir um desenho explicativo.

quinta-feira, 7 de maio de 2015

Estudo dirigido dias 27 e 29 de abril de 2015


P: Como está delimitado  o citosol?
R: Entre a membrana nuclear e a membrana citoplasmática

P: Qual o pH do citosol?
R: Em geral próximo a 7,2 (pH neutro)

P: O que são inclusões citoplasmáticas (ou citosólicas)?
R: Macromoléculas densamente acumuladas no citosol, de forma em geral temporária, que são detectadas ao microscópio e não contém membranas. São constituídas de carboidratos, proteínas, lipídios ou pigmentos.

P. De que são formados os glicossomos?
R: Grânulos de glicogênio

P. Para que servem os grânulos de glicogênio? Que enzimas os degradam para que a célula os use?
R. São depósitos de energia para a célula. O glicogênio hepático mantém estáveis os níveis de glicose no sangue e nos tecidos.  O glicogênio muscular, ao contrário, permanece na célula e é usado em condições de manda rápida de energia (na corrida dos mamíferos, por exemplo). Neste caso, o glicogênio é quebrado em moléculas de glicose-1-fosfato por uma fosfatase.  A glicose-1-fosfato entra imediatamente no metabolismo da glicose para produção de energia.

P. Que colorações são empregadas para evidenciar a presença de glicogênio em tecidos?
R. Tricrômio de Gomori e PAS (Ácido periódico-Schiff)

P. Que células apresentam em geral gotículas de gordura?
R. Hepatócitos

P. Que característica marcante tem o macrófago de um paciente com doença de Gaucher? Que protozoose  pode ser confundida com ela (quando se examinam os macrófagos e com base na clínica do paciente)?
R. Macrófagos com volume aumentando e muitas inclusões pequenas e esféricas ou oblongas. A doença de Gaucher pode ser confundida com leishmaniose visceral humana.

P. O que são pigmentos?
R. São substâncias de cor própria  que se elaboram na célula ou que vêm do exterior

P. Cite três exemplos de pigmentos em células de mamíferos ou aves.
R. Lipofuscina (de cor marrom, constituída de fosfolipídios combinados com proteínas que se acumulam em células  como os neurônios e as células musculares cardíacas)
Uma lista da qual provavelmente extrairão as respostas (terão que selecionar o que é de mamíferos ou aves...):
1. Baseados em Heme/Porfirina[editar | editar código-fonte]
Clorofila (verde)
Bilirrubina  (amarelo ou verde jade=-amarelo limão)
Hemocianina (azul)
Hemoglobina (vermelho-amarronzado)
2. Emissores de luz
Luciferina  (verde-claro)
3. Lipocromos
Carotenóides (alaranjado)
Alfa- e beta-caroteno (laranja)
Cianinas (rosas vermelhas)
Antocianina (vermelho intenso)
Licopeno (vermelho predominante)
Rodopsina (azul cor do céu)
Xantofilas (amarelada)
Cantaxantina (vermelha)
Zeaxantina (amarelo cor do milho)
Luteína (amarelo)
4. Fotossintético
Ficobilina (verde-escuro)
Ficocianina (azulada)
5. Outros[Hematocromo marrom
Melanina (preta)
Ftalocianina (violeta)
Ureia (rosa bebê)
Psitacofulvinas (vários cores vivas dos papagaios e canários)

P. Cristais de proteínas aparecem também no citosol. Examine a bactéria inseticida Bacillus thuringiensis e relacione sua inclusão citoplasmática à sua forma e atividade.
R. Uma proteína inseticida (genericamente chamada CRY) se acumula em grande quantidade no citoplasma da bactéria, formando um grande cristal.

P. Cite exemplos de cristais citoplasmáticos e, quando possível, diga sua função
R. (a) O cristal de proteínas CRY em Bacillus. Função inseticida. (b) os cristais paramagnéticos  em bactérias e em células no cérebro de aves e insetos. Função de orientação magnética. (c) Outros aparecerão, mas provavelmente seu uma função clara.

P. Que moléculas compõem os ribossomos e para que servem?
R. São formados de proteínas e RNA e responsáveis pela maior parte da síntese proteica.

P. O que diferencia os ribossomos procariotos dos eucariotos?
R. As duas subunidades têm mais proteínas nos eucariotos do que nos procariotos, e seus RNAs  são maiores. Na subunidade maior dos procariotos há dois RNAs e na dos eucariotos, 3.

P. Quantas proteínas e RNAs (diga seu “tamanho” em unidades de sedimentação Svedberg) formam cada uma das subunidades do ribossomo eucarioto?
R. Subunidade menor:  33 proteínas e o RNA 18S. Subunidade maior: 50 proteínas e os RNAS 28S, 5,8S e 5S.

P. O que acontece nos sítios A, P e E dos ribossomos?
R. Os tRNAs entram no sítio (ou cavidade) A trazendo os aminoácidos. O peptídeo nascente que estava no sítio P, ligado a um tRNA, é cortado a adicionado ao aminoácido que entrou no sítio A. O ribossomo desliza no sentido P-A, provocando a saída de um tRNA descarregado (sem aminoácido)  do sítio E, a entrada de um novo tRNA descarregado, a ocupação do sítio P pelo peptídeo nascente e a vacância do sítio A. (Este assunto será visto em detalhe mais adiante na disciplina).

P. O que são polissomas?
R. Vários ribossomos associados a um único mRNA

P. As proteínas de membrana são feitas por ribossomos livres no citoplasma?
R. Não. Os primeiros aminoácidos do peptídeo nascente ligam o ribossomo à membrana do retículo endoplasmático e a síntese é feita para o interior dele (síntese vetorial).

P. O que são chaperonas e para que servem.

R. São proteínas que acompanham outras proteínas e têm múltiplas funções, inclusive dobramento/desdobramento de proteínas, transporte através de membranas e regulação gênica